ID: 975276744_975276745

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 975276744 975276745
Species Human (GRCh38) Human (GRCh38)
Location 4:72511108-72511130 4:72511159-72511181
Sequence CCATATGCAAAAATCAAATCAAA CAAATTATGAAACTATTACAAGG
Strand - +
Off-target summary {0: 30, 1: 535, 2: 1685, 3: 9182, 4: 17939} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!