|
Left Crispr |
Right Crispr |
| Crispr ID |
975328693 |
975328696 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:73089334-73089356
|
4:73089383-73089405
|
| Sequence |
CCTATTCTTAAAAAAAAAAATTT |
AACAGGCAGCAGGCCAAATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 93, 3: 1011, 4: 7319} |
{0: 2, 1: 26, 2: 105, 3: 329, 4: 774} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|