ID: 975329350_975329355

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 975329350 975329355
Species Human (GRCh38) Human (GRCh38)
Location 4:73096998-73097020 4:73097034-73097056
Sequence CCTTGAACCATCAGTTTGTTTGC GTAGGAGGAATTTAATTATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 125} {0: 1, 1: 0, 2: 2, 3: 14, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!