|
Left Crispr |
Right Crispr |
| Crispr ID |
975329558 |
975329571 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:73099048-73099070
|
4:73099089-73099111
|
| Sequence |
CCACAACTCCAGGAAGGAAACCA |
CTGGAGAAGGAGGAAGAGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 2, 2: 2, 3: 25, 4: 286} |
{0: 2, 1: 7, 2: 91, 3: 659, 4: 3409} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|