ID: 975370265_975370268

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 975370265 975370268
Species Human (GRCh38) Human (GRCh38)
Location 4:73577973-73577995 4:73577989-73578011
Sequence CCCACCTATCTCTGTTTTCCAGA TTCCAGATTACTGCCCAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 299} {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!