ID: 975437009_975437019

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 975437009 975437019
Species Human (GRCh38) Human (GRCh38)
Location 4:74365030-74365052 4:74365076-74365098
Sequence CCTGCCGCTCCTCCCTCGGGCCA GACCTCACCCCGTTAGGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 867} {0: 1, 1: 0, 2: 1, 3: 2, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!