ID: 975493755_975493758

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 975493755 975493758
Species Human (GRCh38) Human (GRCh38)
Location 4:75015694-75015716 4:75015739-75015761
Sequence CCTGTTCACTTCAAAGGTGAAGA GTGCCTCACCCAAGATCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 196} {0: 1, 1: 1, 2: 8, 3: 62, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!