ID: 975521435_975521438

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 975521435 975521438
Species Human (GRCh38) Human (GRCh38)
Location 4:75305796-75305818 4:75305844-75305866
Sequence CCTAAAACTTGCTGCAAATGTGC GAGAGAAGGAAGGATGCTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 87, 4: 619}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!