ID: 975581708_975581712

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 975581708 975581712
Species Human (GRCh38) Human (GRCh38)
Location 4:75912586-75912608 4:75912611-75912633
Sequence CCAACATGGCAAAAGCCCATTTC CTAAAAATACAGAATAAGCTGGG
Strand - +
Off-target summary {0: 5, 1: 321, 2: 6959, 3: 21341, 4: 83811} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!