ID: 975608833_975608844

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 975608833 975608844
Species Human (GRCh38) Human (GRCh38)
Location 4:76183714-76183736 4:76183759-76183781
Sequence CCCCTCCTGGGAGGTTGGGGGGT TAATCCTGTCCTCTTCTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 74, 4: 363} {0: 1, 1: 0, 2: 3, 3: 34, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!