ID: 975609139_975609141

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 975609139 975609141
Species Human (GRCh38) Human (GRCh38)
Location 4:76186544-76186566 4:76186567-76186589
Sequence CCTGTAGATACAAAGCAGGATAC TGAGAAGAAGTGGTAAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100} {0: 1, 1: 0, 2: 16, 3: 205, 4: 1917}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!