ID: 975629549_975629561

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 975629549 975629561
Species Human (GRCh38) Human (GRCh38)
Location 4:76386736-76386758 4:76386777-76386799
Sequence CCATCCCCCAGCAGTGGCTGTGC AGGGAGAGCACAGCAACTGGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 15, 3: 81, 4: 461} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!