ID: 975647070_975647080

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 975647070 975647080
Species Human (GRCh38) Human (GRCh38)
Location 4:76555783-76555805 4:76555815-76555837
Sequence CCTGTCCCTCCTACCACCTCACC TCCCTACCCTACCCCACCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 72, 4: 699} {0: 1, 1: 0, 2: 4, 3: 78, 4: 637}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!