ID: 975657161_975657165

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 975657161 975657165
Species Human (GRCh38) Human (GRCh38)
Location 4:76653265-76653287 4:76653288-76653310
Sequence CCTTGGTGCTGTTACTGTTTGGG GTTGGATAGTTCTTTGTTGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 17, 2: 129, 3: 379, 4: 907}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!