ID: 975660051_975660054

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 975660051 975660054
Species Human (GRCh38) Human (GRCh38)
Location 4:76679740-76679762 4:76679759-76679781
Sequence CCTGTCCATCCTGCACATAACCA ACCACCTCCCCACACTCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162} {0: 1, 1: 1, 2: 8, 3: 61, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!