ID: 975660051_975660060

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 975660051 975660060
Species Human (GRCh38) Human (GRCh38)
Location 4:76679740-76679762 4:76679773-76679795
Sequence CCTGTCCATCCTGCACATAACCA CTCCCCAGGCACATTCTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!