ID: 975661108_975661117

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 975661108 975661117
Species Human (GRCh38) Human (GRCh38)
Location 4:76689669-76689691 4:76689701-76689723
Sequence CCCGGGGGCGGCGGCCGCGAGGC TGGTGAGTGAGGAGGGCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 488} {0: 1, 1: 1, 2: 1, 3: 54, 4: 620}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!