ID: 975663258_975663268

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 975663258 975663268
Species Human (GRCh38) Human (GRCh38)
Location 4:76708271-76708293 4:76708320-76708342
Sequence CCCTTCACTGTGACAGTCACCAC CCCAGGAAGGAGAAGTGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 229} {0: 1, 1: 0, 2: 4, 3: 67, 4: 753}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!