ID: 975694385_975694391

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 975694385 975694391
Species Human (GRCh38) Human (GRCh38)
Location 4:76997422-76997444 4:76997435-76997457
Sequence CCATTTGCTTATTTGTCAGTTAT TGTCAGTTATGGAAGTTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 629} {0: 1, 1: 0, 2: 1, 3: 10, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!