ID: 975696773_975696786

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 975696773 975696786
Species Human (GRCh38) Human (GRCh38)
Location 4:77021560-77021582 4:77021606-77021628
Sequence CCACCGCGCCTGGCCCCCAAGCT CAGGTGGTGTGAGGTGTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 119, 3: 803, 4: 4208} {0: 1, 1: 0, 2: 3, 3: 19, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!