ID: 975722606_975722612

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 975722606 975722612
Species Human (GRCh38) Human (GRCh38)
Location 4:77262817-77262839 4:77262841-77262863
Sequence CCTACCACAGAAAGGTCAGGGAC CTATCTCCCCGTGGAAAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!