ID: 975732784_975732789

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 975732784 975732789
Species Human (GRCh38) Human (GRCh38)
Location 4:77354034-77354056 4:77354048-77354070
Sequence CCTCCAGAGGGTGTCCTGTGGAG CCTGTGGAGAAGGAACTGGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 152} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!