ID: 975735082_975735093

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 975735082 975735093
Species Human (GRCh38) Human (GRCh38)
Location 4:77373028-77373050 4:77373068-77373090
Sequence CCCAGCCAGAACTGGGGCAGCCG CTCAATCCCCAGAGTAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 9, 4: 147} {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!