|
Left Crispr |
Right Crispr |
| Crispr ID |
975803821 |
975803825 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:78091687-78091709
|
4:78091721-78091743
|
| Sequence |
CCCAGGCTGGAGTGCTGTGGCTA |
GGTCATAGTGCCCTACAGCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 18, 1: 700, 2: 12321, 3: 182013, 4: 262059} |
{0: 1, 1: 0, 2: 4, 3: 28, 4: 225} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|