ID: 975809698_975809701

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 975809698 975809701
Species Human (GRCh38) Human (GRCh38)
Location 4:78154386-78154408 4:78154409-78154431
Sequence CCTTGGTCTATTTGTTTAAAACC CATTTAAAATATTTTTACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 226} {0: 1, 1: 0, 2: 6, 3: 92, 4: 932}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!