ID: 975815101_975815108

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 975815101 975815108
Species Human (GRCh38) Human (GRCh38)
Location 4:78209310-78209332 4:78209338-78209360
Sequence CCTGGAGGTTGCATGCACTGGTG CTTCCCTTCTGGCTTCCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 154} {0: 1, 1: 0, 2: 10, 3: 88, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!