ID: 975817704_975817714

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 975817704 975817714
Species Human (GRCh38) Human (GRCh38)
Location 4:78236181-78236203 4:78236217-78236239
Sequence CCAATAGTGTTGACCAAGTTGTC TAGGTGAGGATCAGATTATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77} {0: 1, 1: 0, 2: 1, 3: 14, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!