ID: 975830566_975830570

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 975830566 975830570
Species Human (GRCh38) Human (GRCh38)
Location 4:78363946-78363968 4:78363973-78363995
Sequence CCTTTCTCCTGCTCCTCATGTGA AACCTCGTGCTGTCCCACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 380} {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!