ID: 975839068_975839073

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 975839068 975839073
Species Human (GRCh38) Human (GRCh38)
Location 4:78455095-78455117 4:78455113-78455135
Sequence CCAGTCCTCTTCTCTTTGCTCTG CTCTGAGGGGCCCCTCCCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 738} {0: 1, 1: 0, 2: 1, 3: 18, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!