ID: 975854443_975854451

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 975854443 975854451
Species Human (GRCh38) Human (GRCh38)
Location 4:78608365-78608387 4:78608409-78608431
Sequence CCTCATGGTGGAGGAAGCATAAT CAGATCATGCAGGACCTTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 24, 3: 118, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!