ID: 975870677_975870693

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 975870677 975870693
Species Human (GRCh38) Human (GRCh38)
Location 4:78776058-78776080 4:78776108-78776130
Sequence CCAACGGCCACGAGTGGCGGGCG CGCGACGGGCTGCGGTCCTGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!