ID: 975922369_975922370

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 975922369 975922370
Species Human (GRCh38) Human (GRCh38)
Location 4:79407519-79407541 4:79407549-79407571
Sequence CCATTGGAATTTCAAAAAAGTCA CTTTATCCCATTCCAAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 30, 4: 453} {0: 1, 1: 0, 2: 3, 3: 14, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!