ID: 975966536_975966546

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 975966536 975966546
Species Human (GRCh38) Human (GRCh38)
Location 4:79979260-79979282 4:79979304-79979326
Sequence CCAACCAGGAGTAGTGGAAAGCC CCAAAAATGGGCGAGGTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91} {0: 1, 1: 0, 2: 2, 3: 12, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!