ID: 975985936_975985942

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 975985936 975985942
Species Human (GRCh38) Human (GRCh38)
Location 4:80201996-80202018 4:80202027-80202049
Sequence CCCCAAGAGACTTCACAGCGCTG CCCCAAGACGAACAAGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 180} {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!