|
Left Crispr |
Right Crispr |
| Crispr ID |
976000610 |
976000616 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:80370080-80370102
|
4:80370102-80370124
|
| Sequence |
CCTCAGGAAACTTACAATTATGG |
GCAGAGGGTGAAAGGGAAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 477, 1: 6480, 2: 8361, 3: 6485, 4: 4125} |
{0: 1, 1: 52, 2: 297, 3: 857, 4: 2291} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|