ID: 976005327_976005337

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 976005327 976005337
Species Human (GRCh38) Human (GRCh38)
Location 4:80423443-80423465 4:80423491-80423513
Sequence CCCTTTTCTCCAAATTTTCTAAG ATTGTTTTCTGGGGCAGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 114, 4: 911} {0: 1, 1: 0, 2: 0, 3: 24, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!