ID: 976012743_976012745

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 976012743 976012745
Species Human (GRCh38) Human (GRCh38)
Location 4:80510950-80510972 4:80510967-80510989
Sequence CCTCTGGCTTCTTTTAGCCATCT CCATCTAGTGAGAATGAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 239} {0: 1, 1: 1, 2: 1, 3: 15, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!