|
Left Crispr |
Right Crispr |
| Crispr ID |
976013093 |
976013098 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:80516348-80516370
|
4:80516396-80516418
|
| Sequence |
CCTTAGGCTAGGTAATTTATAAA |
TTCTGTGGGCTATACAAGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 153, 2: 2194, 3: 13353, 4: 16311} |
{0: 1, 1: 1, 2: 15, 3: 85, 4: 576} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|