ID: 976063871_976063876

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 976063871 976063876
Species Human (GRCh38) Human (GRCh38)
Location 4:81161610-81161632 4:81161628-81161650
Sequence CCCATTTCCTTACTGACTGACAG GACAGTGGGAACTGCTCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 64, 4: 343} {0: 1, 1: 0, 2: 1, 3: 9, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!