ID: 976064154_976064165

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 976064154 976064165
Species Human (GRCh38) Human (GRCh38)
Location 4:81164620-81164642 4:81164664-81164686
Sequence CCACCATTAGAGTGTTAGGTGTG GTTTCCGATTCAGTAAGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89} {0: 1, 1: 2, 2: 37, 3: 322, 4: 1024}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!