ID: 976079149_976079152

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 976079149 976079152
Species Human (GRCh38) Human (GRCh38)
Location 4:81335411-81335433 4:81335444-81335466
Sequence CCTTGCTCATTTTTTAGACCCTA ATTGTTTTAATTAACATTTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 13, 3: 116, 4: 1228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!