ID: 976092407_976092425

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 976092407 976092425
Species Human (GRCh38) Human (GRCh38)
Location 4:81471927-81471949 4:81471975-81471997
Sequence CCGCGCACGCCCCCCTTGGCTCA CGCCCCGCCCCGGCAGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 121} {0: 1, 1: 0, 2: 2, 3: 46, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!