ID: 976111285_976111289

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 976111285 976111289
Species Human (GRCh38) Human (GRCh38)
Location 4:81676669-81676691 4:81676700-81676722
Sequence CCAGGCTGTAAGAAAGGAAAGGC AATGCGGAACTGCTGCAGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223} {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!