ID: 976112300_976112304

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 976112300 976112304
Species Human (GRCh38) Human (GRCh38)
Location 4:81688942-81688964 4:81688956-81688978
Sequence CCACAAGAACGGGAGCAGTGGTA GCAGTGGTAGAGGTGATGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 57, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!