|
Left Crispr |
Right Crispr |
Crispr ID |
976122715 |
976122718 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:81800540-81800562
|
4:81800583-81800605
|
Sequence |
CCAGTCTACTCCGTAATCTCGTT |
AAACCCTGCTTCACAAAGATAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 11, 2: 26, 3: 30, 4: 48} |
{0: 20, 1: 32, 2: 26, 3: 28, 4: 193} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|