ID: 976139306_976139311

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 976139306 976139311
Species Human (GRCh38) Human (GRCh38)
Location 4:81973694-81973716 4:81973742-81973764
Sequence CCTTTATGATCTTTATATTCCAT TGCTTCTCATGTCAGTTCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 538} {0: 1, 1: 0, 2: 2, 3: 16, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!