ID: 976196575_976196584

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 976196575 976196584
Species Human (GRCh38) Human (GRCh38)
Location 4:82537814-82537836 4:82537852-82537874
Sequence CCACCAGAAGCTGGAAGAGGTGA TAGAGCCTTCAATAGGAGCAGGG
Strand - +
Off-target summary {0: 7, 1: 34, 2: 226, 3: 708, 4: 1639} {0: 1, 1: 1, 2: 6, 3: 88, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!