|
Left Crispr |
Right Crispr |
| Crispr ID |
976208593 |
976208596 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:82645033-82645055
|
4:82645051-82645073
|
| Sequence |
CCAGGCACCGGTGGCTCACACCT |
CACCTGTAATTCCGGCACTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 42, 2: 157, 3: 657, 4: 2411} |
{0: 23, 1: 3804, 2: 81357, 3: 218318, 4: 255724} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|