ID: 976213103_976213112

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 976213103 976213112
Species Human (GRCh38) Human (GRCh38)
Location 4:82691770-82691792 4:82691796-82691818
Sequence CCTTGCACCAGCTGGTTTCCTAA GAAGCTGGGGCCATGGTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 280} {0: 1, 1: 0, 2: 0, 3: 19, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!