ID: 976236298_976236307

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 976236298 976236307
Species Human (GRCh38) Human (GRCh38)
Location 4:82900819-82900841 4:82900870-82900892
Sequence CCGCAGTGGGCTGCAGCACCCGT TCTCCTTCCACCAGTGCGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 242} {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!